Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14766G11
Clone ID IST14766G11
Vector VICTR76
Project tigm

Sequence tag IST14766G11BBF1
Sequence
GGCCAGTATGGAATTTTACTGATTGTGTAAAATTGATTCCTTGACTCCTCATGGTGAATGTCAACTACTGCCAAAGCAGA
AAGGCCTCACCTACCTTATTCCTCCTCCTCTTCTGTGCTGCAAGTAGACCAGCTTCAAAGTTGGTCAGTGAACTCAACCT
TATACCTGTCCCTCTTTATTTGTAATCCCCTAACTTGTAACCCTGTCACCCAGGGAGGTTAGACAACACTCATTCCCTGG
TGTCTTTTGGCTCACTGATCAGTCAGAACCCAGCCTGAAAGCAGCTGTAGGAATGTTTTCCAAGCCCTGGGCAGCAGANG
CAGGATTCGGAGTTCAAAGCAAGTCTTTACTCCATGGCATAAAGAAAAAGCTACAGGAGANGTTTCTCTAAGCAGACAGA
TATGAAATCTCTTTAAAAATAGGAATGATATTCTTAATTTGGGGTNNATATTGGNAGAACAGAAACATGNNNAGNTCACN
TATGGATAGTGAAAATGAAATTTAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177571668..177572174 482
 
EST/CDNA Est Name
  CN690235.1 - CA883508.1


Sequence tag IST14766G11HMR1
Sequence
GCGTGTGTGTACATGTGTGTGAGCTACCCATCCCCGCCTCCTCAGCACTAGCTTACAGGCTCCACCACCCGACTCTTGTT
AGATA
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121270394..121270477 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14766G11HMF2
Sequence
GGCCAGTATGGAATTTTACTGATTGTGTAAAATTGATTCCTTGACTCCTCATGGTGAATGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177571668..177571732 65
NO GENE  

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es