Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14535E10
Clone ID IST14535E10
Vector VICTR74
Project tigm

Sequence tag IST14535E10HMR1
Sequence
GGAAGAAGGGGTGTATGAACTAAATCTTCCNTGGAGGGAAGCAAGGACTTGCTTGCTTGTGGGACTTGGGAGGGATGAGC
TACAGTTGGGTGTGTTTGTTTGCATGCAGGGCTGTGAGCCTGCTAGGTAAGTGGGTAGCTAGGTAAGTGGGTAACTAGGT
AAGTGGGTAGTTCTTGATTTCTCCAAANAGCTACATCCCCAACCCTTGAGAGCATGGGGTGTTTATTTGTTTGTTTGGGG
TTGTTTGTCTGTCTGTTTTTGCTTTTGAGACNAGGTCTCAGGGTGTGGCCCCTGCTTGGCCTGGAACTCACCACATAGAA
CGCTCATANAAACCCNNCTGCCTCTGNNTCCCTNANTACTAGAATTAANGGCCTGTGCTATCATGGCTGGCTGATAGATG
NTTCNGTTNNTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113283369..113283776 382
 
EST/CDNA Est Name
  CB954982.1 - BQ830144.1 - BM730332.1 - BI101509.1 - BY148512.1


Sequence tag IST14535E10HMF1
Sequence
TTCCCCACCCCTGACCCCGGCACCTGCCCTCTCTCTGACCCTGCCCCCAACCCAGGACCCTGGAGTCATGACTTAGTGAG
TCTGTTATTTGCTGTTATTTGCTTCCTGCTCCTGTGACTTTGAAACCGCTCTTCTTCATCGAGGAACTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI14978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113283220..113283372 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031750 (Il34) NP_001128572 interleukin 34 Gene [Source:MGI Symbol;Acc:MGI:1923777]

 
Come back to gene ENSMUSG00000031750


For any suggestions or comments, please send an email to unitrap@crg.es