Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14664F5
Clone ID IST14664F5
Vector VICTR74
Project tigm

Sequence tag IST14664F5HMF1
Sequence
TACTGACCCTCCCAAGAAAAAAACAAAAAACAAGCTTATTTTATCACATGGTGCAATGTTCCCTTTCAACCTCCAGAGTC
GAGCTTGAGTCACTCTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57286306..57286407 102
NO GENE  


Sequence tag IST14664F5HMR1
Sequence
AGTAGTGGTGGGAGAGAATNNNATATTATAATGTTCAGATATTATAATGCTGGACACTTCTGGACCAGCATGATAGGTCA
GGGAATGCAAACATGTACAGCCTTATCTTGGTCTGAACCAGTGGGCTCTGTGGTTAAGATGGAGGGTGGTCTACCATCTT
AACTGTCTGCCAGAGCTAAAGGAAGTGTGCANGAAAATCCGTGCTCTGAANCATCANAAGGGGCGN
Sequence Type genomic DNA
Unitrap ID UNI22626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57286085..57286309 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es