Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11647G1
Clone ID IST11647G1
Vector VICTR76
Project tigm

Sequence tag IST11647G1HMF1
Sequence
TTACATTTTAAAAACTACTCTGTTGTCGCCTACCTGCACCCGCGTCTCTAGAACTACAACACCCANAATGCACTGTTTTT
CCTTCCGCTTTCTACCTANGGAGTGCCTTANAAATTCACATCTACAAACTACAGTCACATGACACGTTTCCTGTCAAGAT
GGCGGATAATCTCCCTTCGGACTTTGATGTGATCGTAATAGGGACGGGTATGTGTGGCCCTGATTTTTCCTGGACAAAAT
ATANGANATNATTCTNNCTTTTTATTTTCTCTGTCAGTGGTGAGGGTTGGCGAGAAACGGCGGGGGTCNAGCCTGGGAGG
GAGGACAGAAAGGAAGTGAGGTANTGTGGANTCAGCGCANGACTTGGCAA
Sequence Type genomic DNA
Unitrap ID UNI474

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 110298888..110299254 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025531 (Chm) NM_018818 choroidermia Gene [Source:MGI (curated);Acc:Chm-001]

 
Come back to gene ENSMUSG00000025531


For any suggestions or comments, please send an email to unitrap@crg.es