Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13682E9
Clone ID IST13682E9
Vector VICTR74
Project tigm

Sequence tag IST13682E9HMR1
Sequence
CCTAAAGACAAAACTCTAATCGTAGGATAATTTTGTTCATTTATTTGCTTTCTTTAAGGAAAGCGTGATCTGTTAGGTGA
CATTAAAAGCCAGGACTTTCCGCAGTTTCTAACTTAATATGTGTTACGAATCTGTTACCTGTATCAGTATTTTCATACTT
AGGCTGGCCCTGTGTGTGTGGACCGCAAGTGTGGAGCCAGTGGAGCCTCTAAATTCGTTCGGGTTTGGGAACAGGGTACC
TGCCCTTGGATTCTTTAAGCACCGTGCCGCACAATCTCTTTGCCCCAGCAGCCTCCTTGCTAGTCTCTTAACCAATTTAA
GTGCTCAACCCTTGACATTTTTTTCATGACCACTCTCATGTTCCTGTTATGTGAGATATCCTTCGTTTCTACTCCTCTGT
TATTCCACTGTGTACTGCTGTAACNANTCNACTGTCNAATGTTAAACNNNNTGCTTTACTTTTNCCCCTCCTTGCTTANT
TGN
Sequence Type genomic DNA
Unitrap ID UNI29866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181256176..181256656 458
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000826 (Dnajc5) NM_016775 DnaJ (Hsp40) homolog, subfamily C, member 5 Gene [Source:MGI (curated);Acc:Dnajc5-001]


Sequence tag IST13682E9HMF1
Sequence
CTTTCTTAAAGGGTTGAGAAGGTCAGACAAAGTGGTCACTTCATTTGATGGACACCCAACCCTTGCCTGCAATGTTTGTT
TTCCCTCCATTGCCTGGGTCAGGAAGACACTGTTGGAGAGGGGATGTTTCCCAGGGAGAGGTGCAGGTACACGGATTTCT
ACACTCTGAAGTCGCCGGGAAGGGAGGCGTGGGGTTTCAGGTTGCCTTCCCCNNNNNNNNNGTCNNNNNNNATAACCCTT
GNNGAATTCTTTGNCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000826


For any suggestions or comments, please send an email to unitrap@crg.es