Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14414F4
Clone ID IST14414F4
Vector VICTR74
Project tigm

Sequence tag IST14414F4BBF1
Sequence
GTGAGCTACCCTGTGGTTGCTGGGAATTGAACTCAGGGCCTCTGGACCTGGAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32718

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45012381..45106111 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036097 (6030443O07Rik) NM_001081225 family with sequence similarity 178, member A Gene [Source:MGI Symbol;Acc:MGI:1924968]


Sequence tag IST14414F4HMR1
Sequence
TCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCCTTCTCCTTCN
Sequence Type genomic DNA
Unitrap ID UNI32250 UNI36239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 8830505..8830572 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4676645..4676712 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8712433..8712500 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 5799444..5799511 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8406252..8406319 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 9568906..9568973 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8530781..8530848 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5332268..5332335 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9296484..9296551 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10990364..10990431 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3309145..3309212 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7773017..7773084 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7204672..7204739 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4397079..4397146 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 15394737..15394804 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 15125157..15125224 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029563 (Foxp2) NM_053242 forkhead box P2 Gene [Source:MGI (curated);Acc:Foxp2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3489309..3489376 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6609466..6609533 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3136044..3136111 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166386: 181084..181151 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6281545..6281612 68
NO GENE  


Sequence tag IST14414F4HMF2
Sequence
TGAGCTACCCTGTGGTTGCTGGGAATTGAACTCAGGGCCTCTGGAN
Sequence Type genomic DNA
Unitrap ID UNI32718 UNI36301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 63301590..63301634 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 55236433..55236477 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45012382..45012426 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036097 (6030443O07Rik) NM_001081225 family with sequence similarity 178, member A Gene [Source:MGI Symbol;Acc:MGI:1924968]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15820169..15820213 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028222 (Calb1) NM_009788 calbindin 1 Gene [Source:MGI (curated);Acc:Calb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 87360492..87360536 43
NO GENE  

 
Come back to gene ENSMUSG00000028222


For any suggestions or comments, please send an email to unitrap@crg.es