Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14593A12
Clone ID IST14593A12
Vector VICTR74
Project tigm

Sequence tag IST14593A12HMF1
Sequence
AACTGACTTTCACTGTGAACAGATCGGCCTACGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65208218..65208253 36
NO GENE  


Sequence tag IST14593A12BBF1
Sequence
AACTGACTTTCACTGTGAACAGATCGGCCTACGGTTGACCCTGTCTAGGGGTGTGGGGATAGTGACACCTCGTTTACTAC
TGGGGGCTTTGAGAAACACCACCTGTCAAGCAGGAAGCACTTTAGGAAACAAACACAGAGCACGATGTTATCAGTTAAGA
GTTGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65208087..65208253 167
NO GENE  


Sequence tag IST14593A12HMR1
Sequence
AAATGTATGTGTAAAACGCATTGAGCACAAAAGGAGGAAGACAGAAAGCGTTC
Sequence Type genomic DNA
Unitrap ID UNI2083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65208257..65208308 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es