Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13969H11
Clone ID IST13969H11
Vector VICTR74
Project tigm

Sequence tag IST13969H11BBF1
Sequence
GTAACAGAATAACTTTCTCATCTCCCAGTTTTGATTTCTTCACAATGTTTAGTAGTGCCTGAAATAATCTTGATTATTCT
ATTATTTTGTGTACACACTATTTATAGTGCACCTACTATGTGTCAAGCACTGTATGTACTTGCCATAGGATTGGAGGCGC
CATAAAGTAAGGATCTTTAACTGTCCAGGTCACTCGAGTCTACACAGGATTCTATAGCCCTGGGACCTGCACACAGTAGG
CACATTTCTCTATTCCGCGCTCTTCCCGGTTAGCCCCTCCCCCGCTCCAGGAAGTGAGGGGGTTCTAGCCGCCTGGCCTA
CCGCGATGCATTTTGGGAAAGCAGCAGCACCAGATCCAAGANGGCGGCCAGCANGANGCTGATGAANGTAAAAGCCATTC
TCTGGCGCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI13985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17201502..17201914 405
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]


Sequence tag IST13969H11HMF1
Sequence
GTAACAGAATAACTTTCTCATCTCCCAGTTTTGATTTCTTCACAATGTTTAGTAGTGCCTGAAATAATCTTGATTATTCT
ATTATTTTGTGTACACACTATTTATAGTGCACCTACTATGTGTCAAGCACTGTATGTACTTGCCATAGGATTGGAGGCGC
CATAAAGTAAGGATCTTTAACTGTCCAGGTCACTCGAGTCTACACAGGATTCTATAGCCCTGGGACCTGCACACAGTAGG
CACATTTCTCTATTCCGCGCTCTTCCCGGTTAGCCCCTCCCCCGCTCCAGGAAGTGAGGGGGTTCTAGCCGCCTGGCCTA
CCGCGATGCATTTTGGGAAAGCAGCAGCACCAGATCCAAGANGGCGGCNAGCANGANGCTGATGAANGTAAAAGCCATTC
TCTGGCNCTGGT
Sequence Type genomic DNA
Unitrap ID UNI13985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17201504..17201914 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]

 
Come back to gene ENSMUSG00000038965


For any suggestions or comments, please send an email to unitrap@crg.es