Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12473B2
Clone ID IST12473B2
Vector VICTR76
Project tigm

Sequence tag IST12473B2HMF1
Sequence
ATGCAACAGCACAGAAGGCTCCTGCTTCAAACCCTGAGCAGTAAAGGGATCCCTGTANAGGTGAGTCCTCTGGAGTGAGT
GCCTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI31190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3843736..3843823 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082848 (AC133523.2)  


Sequence tag IST12473B2BBF1
Sequence
ATGCAACAGCACAGAAGGCTCCTGCTTCAAACCCTGAGCAGTAAAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3843773..3843823 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082848 (AC133523.2)  

 
Come back to gene ENSMUSG00000082848


For any suggestions or comments, please send an email to unitrap@crg.es