Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST445189
Clone ID OST445189
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST445189
Sequence
GACTGAGGAGCTTGAAGAGATCCGCAAATGTGGAATGAAAAACTTCCGTAACATCCAGGTTGATGAAGCTAATTTATTGA
CTTGGCAAGGGCTTATTGTTCCTGACAACCCTCCATATGATAAGGGAGCCTTCAGAATTGAAATCAACTTTCCAGCAGAG
TATCCATTCAAACCACCCAAGATCACATTTAAAACAAAGATCTACCACCCTAACATCGATGAGAAGGGGCAGGTCTGTCT
GCCAGTCATTAGTGCTGAAAACTGGAAGCCAGCCACCAAGACTGACCAAGTAATCCAGTCCCCTCATAGCACTTGGTGGA
ATGA
Sequence Type mRNA
Unitrap ID UNI14005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27656195..27656510 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064208 (AC160404.13) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TW19]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87011587..87011902 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074506 (AC102115.11)  

 
Come back to gene ENSMUSG00000074506


For any suggestions or comments, please send an email to unitrap@crg.es