Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14788C2
Clone ID IST14788C2
Vector VICTR76
Project tigm

Sequence tag IST14788C2HMR1
Sequence
TNNTACAACCTGGCAGGAGAGGCCTCCCGGCATGGCTCCAACCCCAGGGTAAGTCAGGTTTGGGCAAACCAGCCGGTGAG
CCAGGCTGGTGTTCAGGTGACTACTCAGGATGCTCTCACTCTATCCAAACCACTTCCCTTCTGTCCACAAAAGGATGATT
CTGTTCAGCCAGGAATGAAACTACNCCGTAAAAGGATGGGTTTTCTGTTTGTTTTGAGACAGGGTTTCACTCTGTAGCCC
AGGCAGGCCTCAAACTCANGGCCTCTGCCTCCTCAATGTTGGGATTAAAGGTCTGCACTANCACACNNNGAGAGAAAACA
TCTTACANGGANAAAGTANNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292714..114293048 319
 
EST/CDNA Est Name
  BQ043678.1 - BY433112.1 - BB689709.1 - BB689731.1 - CJ216410.1 - BY611115.1 - BB689730.1 - BB689157.1 - CJ218029.1 - CJ218443.1 - CJ302793.1 - CJ208399.1 - CJ217958.1 - CJ210040.1 - BY639701.1 - BY380601.1 - CJ208031.1 - BY683316.1 - BY633860.1 - BY603648


Sequence tag IST14788C2HMF1
Sequence
CTAACACTGTTTTTGTCTTTATCCAGGTACATTGAGCGGAAAGCTTTTCTGGATCGAGTGGACCACAGGCAGTTTGAAAT
TGAGCGAGATCTCAGGCTGAGCAAAATGAAACCTTGACATTCTGGGAAGGATTCCTAGCAGCTGAATCCTATTGACAATG
TGAGCTCCTCTGAGTGTCTGTGAAATACTTCCAGTGTTCCTCATCATGTTTCCAGCAAGTCCCTTTTTCTACGTTGCAGT
TTGTTTAATGTATGTTAATTTCACCTGGCTTCATTCATTTTCCTTTTTAAAATTTGTCTTTTAAATAAACAAACNGAACC
CTCTGTGAGGTTGGTGANANTAANGGNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292368..114292713 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST14788C2BBF1
Sequence
CTAACACTGTTTTTGTCTTTATCCAGGTACATTGAGCGGAAAGCTTTTCTGGATCGAGTGGACCACAGGCAGTTTGAAAT
TGAGCGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292622..114292713 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es