Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12832E4
Clone ID IST12832E4
Vector VICTR76
Project tigm

Sequence tag IST12832E4HMF2
Sequence
GGGGAGAGCCCATACCAAGCCCCACAAACTCCCTACACCCGCTCTCAAGTCTGTCTGGAAATGTTATGANCACAAANANC
ACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148287156..148287237 76
NO GENE  


Sequence tag IST12832E4HMR1
Sequence
CNNCCCCATCTTTCTTTTTTAATCTCCTTTTCTCCTTTTTGGGACAAGGACAAGGCAGAGGGAGAAAATTGCTCTACGCT
GCAAACAGTTGCTGGGTTTATTCAGAAAGGACTGACCAGCAACAGTTGTTCCTCTTACAGAGAAATGCANGAACAACTGG
GGCCTTCTTTGTTCTCTGGGCAGAGTCCTGTGAAGGGCATTTGGAGGTGAGCCTGGGGCTAAAGAGGGCAAGACACTCAC
AGTGTCNATTGANTCCCC
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148287235..148287488 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es