Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11677F11
Clone ID IST11677F11
Vector VICTR76
Project tigm

Sequence tag IST11677F11HMF1
Sequence
CCTGAGCTGTCTGGCTGTAGATGTACCATCCCCACATCCTCCTTGGCTTCAGAGCCAGTGGGAGTTAGGTACACACAGTT
TCAGGCCTGCTTTCCAGCTCTCTCTGTCTTAGGCCACCTTTCAGGCCAATTGGCAGAAAATTGAATGCCCCAGGGCCCAG
GCACCAAGGGGTGAGAAAGGCAGGACTCTGCTCAGAAGGCAGAGCCTACAGAAGGTACCAAATTTACTGTTGAGTGATTG
AGATTGAAAGAGTAGTAAACTCAGTGCTCCAAGGTATGCTAATCATAAAACAGATAGTGACATTCCTCCACCCACCCACT
TCCTGAGTTCAAGGAGTATTCATTCAAAGAAAGTCACCTTGACTTTCTTTGAATGAATACTGCAATGCNNATGTGCTATT
GTTAGAGGCTCTTANAAACTGTCTTGAGAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI22780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84649492..84649926 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027078 (Ube2l6) NM_019949 ubiquitin-conjugating enzyme E2L 6 Gene [Source:MGI (curated);Acc:Ube2l6-001]

 
Come back to gene ENSMUSG00000027078


For any suggestions or comments, please send an email to unitrap@crg.es