Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14656D4
Clone ID IST14656D4
Vector VICTR74
Project tigm

Sequence tag IST14656D4HMF1
Sequence
AGCTGAGTGGCTTAGAAGCACTTGTCTCTGAACCGCCTGGGTTCTTCATCTGAAAGATGGAAGGAAGCGTAAGACCCTGA
TTCATGGGAAAGAGGATGAAACGTGGAAATGCCTAGAGTGAGCATGGGGCAGGGTAGCTGACTTCTGCTGCTCTGTGGGT
TCTTTCTTCCGCCCTTCTTCACCCTTTCAGCCCCCCTAACACTAGAGAGGAAAAGAGGCAATGTTATAGTTAGACTACCT
CCTGCTGATCAGGGGCATCAAGTTTGTTCTCACCCCAGGATACCTAATTTCTTCTTTCTTCTGCGTCATGACTATATAAC
AAAGCACACCCATCAGCAACCAAAAATCAACCAATCNATAACTAACAATCCANCCTGCCTCTCAGGGAACTAGCATTTAT
ACACTCTGAAAAGTCCCTANAATTCCAAATGTNNCACAATGGCAGACTGTCTGCCTTTNGCAAACCATGTCCCTGCTNNA
NCACNAGGCNAATCANANTCAGCTGCTGTGNNNATCTAANNCANCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26728490..26729018 483
 
EST/CDNA Est Name
  AV010154.1


Sequence tag IST14656D4BBF1
Sequence
AGCTGAGTGGCTTAGAAGCACTTGTCTCTGAACCGCCTGGGTTCTTCATCTGAAAGATGGAAGGAAGCGTAAGACCCTGA
TTCATGGGAAAGAGGATGAAACGTGGAAATGCCTAGAGTGAGCATGGGGCAGGGTAGCTGACTTCTGCTGCTCTGTGGGT
TCTTTCTTCCGCCCTTCTTCACCCTTTCAGCCCCCCTAACACTAGAGAGGAAAAGAGGCAATGTTATAGTTAGACTACCT
CCTGCTGATCAGGGGCATCAAGTTTGTTCTCACCCCAGGATACCTAATTTCTTCTTTCTTCTGCGTCATGACTATATAAC
AAAGCACACCCATCAGCAACCAAAAATCAACCAATCAATANCTAACANTCNNNCCTGCCTCTCANGGAACTAGCATTTAT
ACACTCTGAAAAGTCCCTAGAATTCNNAATGTCNCACNNTGGCAGACTGTCTGCCTTTGGCAAAACNNTGTCNNTGCNAN
ANCACGANGCANATCATAGTCANCTGCTGNGGNCNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14656D4HMR1
Sequence
TAAGGCCCAGGGGATGGAACCTGGGCCTCGTGGGCAGTAGGGATTAAAAAAACAGGTACCTGGCTGTGTCCAGACAATGG
AGTAGTATTTGGTCCTGAAAAGCAGTGAGCTGTAAAGGTGGGAGAAGACATGGAGGGCCCTCAGGACATGTCACTGAGTG
TAGGAAGCTGGTCTACAAAAGGGCCANAGCCATTGAACAACATTCCANACGAGTTAGGGCANTGTCNNTACCCATCTGTC
CCCAGCTCTCCG
Sequence Type genomic DNA
Unitrap ID UNI1463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26729018..26729268 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001576 (Ergic1) NM_026170 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene [Source:MGI Symbol;Acc:MGI:1914708]

 
Come back to gene ENSMUSG00000001576


For any suggestions or comments, please send an email to unitrap@crg.es