Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13042E12
Clone ID IST13042E12
Vector VICTR76
Project tigm

Sequence tag IST13042E12HMF2
Sequence
TCTTGTGCGGCAACGGCTGGGTGAGGACTCAACGGGGCCCCGTCCTGTCTANGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI36246

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108295171..108295227 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032611 (1700102P08Rik) NM_053216 RIKEN cDNA 1700102P08 gene Gene [Source:MGI Symbol;Acc:MGI:2148248]


Sequence tag IST13042E12HMR1
Sequence
AAGAGTGCCCAACGGTCACTGAGTCCACGTTCCNAGACCNGCGATTCCCAACCCCCACCTACTAGGTTAAAGGTCGAGGT
GAAGACTCACATGACCCCAATGGGAACAAAGGCCCTAGAGCTGGCCTGTTAGGTTGCCGGCTTTGCCACTAGGGGAGTAA
GGGAAGGGTTAAGGAAGAGAATCCGGTCTGGAGAGGGTCTATTACCGAAAAAGTATTTTCTTAAACCTTATTAACTNNNA
TGTTTGGAGATCTGAAAAATACCCATTGTGTTCTTCTGAANCTAACNTGGANAAACAATGCCNCACACTGCACCCANTTT
TATGAATAGACTTCTTTTAAGGGAGAGCTNATGAAAGTTCCACATANANNCNNNTNATNAAGGGNNNNNNNGGACAAANC
NNANCTTCTANGANTCTGTGANAAACTGANNACNNTNNCCCAATACTNACTTCNNTTNNTANCCGGGAAGGCGGCTGNNA
AATTCTGAGAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13042E12BBF1
Sequence
TNNNGAGCGGGANCGGNNGNNNNANGACNNNNGGGGGCCNNATCCNGNNNNNGCTGGCNATAGTTTGGGGGCCCANACAG
CAACTGGGCGCAGTAGTGGGTGGAGGGAAAAGGCTTANCGGCCTACAGGCTAAGGAAGCTCTGGGCGGTGAGGCGGGGCG
TCTCGGGCCCTCCCCCGTGACCCTGGGTCCTCTGANAATCCCGTGACCCTGGGTCCTCTGANNATGGCGGGTGATCCGCC
CCTCCGANGAAAAGAACGAAGGATGATGTTGTATAACCGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032611


For any suggestions or comments, please send an email to unitrap@crg.es