Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST444991
Clone ID OST444991
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST444991
Sequence
TTTGAGGTAACCTGCGCTTCATCCAGGTGTTCCTGCAGAGCATCTGCGATGGGGAACGCGACGAGAACCACCCCAACCTC
ATCCGAGTCAACGCCAACAAGGCCTATGAGATGGCCCTGAAGAAGTACCATGGCTGGCTGGTGCAGAAGATCTTCAAGGC
CGCNCTGTACGCANCACCTTACAAGTCCGACTTCCTCAAGGCACTCCTGCAAGGNGCAGAACGTGACAGAGGANGAGTGC
CTGNAGAAGATCCGCCTTTTCCTGNNCAACTACACGGCCACCATTGACGCCATCTACGACNTGTACACAAAGATGAATGC
TGAGCTTGACTACACAGNGTAGGCGCCCGGACACACAGTCCCATGTGGGCACCAGCAACCCCATCACTGTGAATCANGCT
GGAATTCCCCAGCTCANNCAGCCCANCCTGCCCAGTACTGGGNTCTGCAGGNGGCNGCCTTAGCTTGTTAGAGGTCTTT
Sequence Type mRNA
Unitrap ID UNI17332

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115120281..115124210 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011884 (Gltp) NM_019821 glycolipid transfer protein Gene [Source:MGI (curated);Acc:Gltp-001]

 
Come back to gene ENSMUSG00000011884


For any suggestions or comments, please send an email to unitrap@crg.es