Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14626G3
Clone ID IST14626G3
Vector VICTR74
Project tigm

Sequence tag IST14626G3BBF1
Sequence
TTGTGGCTCATGCTGGCCTGTACTTGGGTTGCAAGGGCCAGTCACCTGGTTTCCAAGCTAGTTGATTCCTTTCGTAATGA
GACTTGTTGATGCCTACACATAGGCTATTTTTATATGGTCCCATTANAAATAAATAACTTGTCAAACAGAACTCGCCACA
GAGTTCTCATATTCTGCGCCATCTACTTAGTACTTCCTCCCCGTGTCTCTCCTAGCCTGCAAGAACCTTCTAACCCCATT
CCCAACCCCCAGGCTCTTGTCCTGACCTCTACTATGAAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102932584..102932867 280
NO GENE  


Sequence tag IST14626G3HMF2
Sequence
CCCTGAGNTGCTCTCTGTCTCTGCAACTCTTGACTCCGCCTCCCTTTTCCCTGTCCAATCACAGGTCTCCTCTGCACTAA
TGTAATTGGACGGGGAAAATCCTGTGCTGCCTCTGACTTGATTTTATCTTATATTTTAATAGGCTCACTGTATGTTCCCA
GCGGGCCTAGAACTCAGAGTTCTGCCCGCTTCTGTCTTCCTTGTGCTGGGATTAGAATTAGAGGTGTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI17830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52797819..52798050 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040428 (Plekha4) NP_683729 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 Gene [Source:MGI (curated);Acc:Plekha4-001]


Sequence tag IST14626G3HMR1
Sequence
ACAGTATGAGACCTGTCTNAGAAAGCAAAACGAAAAATAGACAGCCTTCAATTTTGCAAAAAGAAATATTAGAACTGTGA
AACTAGCTATCAGTGCAGTCATAAACGTAGTTAAAAGGCATCAAAACTTGTGTGTTTATGTTGAGACAGGAGATTGGCTT
CAAATCCCCAGTCCTCTGCCTCAGCCTGAGCGCTGGGATCGGCACTGTTCTTGGCTTCCTTCTGAAGTACTTTATTCNCT
TTTGAAAACATGCAAGAACGAGTAAGCTCTCTCCTCTGCCACTAGACTGCCTGCTGCCACTTGACCACCATCCGTGTTCC
TCGCTTGTACTTAATANAATTCTACAGATGTANCCNTTTGTTGCCANTCAAATTTTCAGGTTNAAAGGACTTTTGTAGCT
CTCANAGTTTCTACTTTCTTCCCNCTCANTTTTTCCTATGTN
Sequence Type genomic DNA
Unitrap ID UNI14457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102932865..102933305 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es