Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12588F11
Clone ID IST12588F11
Vector VICTR76
Project tigm

Sequence tag IST12588F11BBF1
Sequence
NGNNNGAGAGATCAGTCCCTTTTTGTTTTTTTGTTTGTTTGTTTTTTTGAGACAGGGTTTCTCTGTATAGCCCTGGCTGT
CCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGTCTCTGCCTTCCAAGTGCTGGGATTAAA
GGCATGCGCTATCACCACTGGAGATCCGGCCTATCTACATAGTGAGTTCTAGCCCAGCCAAGGCTACATACTGAGAGCTT
ATCTTGGGAAAAAAAGAAAATAGGGAGGAAAATCCTAAAAGATGTTTTTTACTANACAGTGAGGTGACTCTGTGACTGAG
GCAAAGTAAGCTGTGGGTGTGGTAAATGGCCTTCTTGTTCCCTTCAAAGGCTCCCTTGTCTCCGCAGCTACAGGAGTTGG
TGCCTCACCTTCCANGGACACTGTGTGGCTGACGACAGCAGCCCGGGCCTCAGGGAAGAAAAGA
Sequence Type genomic DNA
Unitrap ID UNI36247

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136439225..136439682 454
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029699 (Srcrb4d) scavenger receptor cysteine rich domain containing, group B (4 domains) Gene [Source:MGI (curated);Acc:Srcrb4d-002]

 
Come back to gene ENSMUSG00000029699


For any suggestions or comments, please send an email to unitrap@crg.es