Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12058G9
Clone ID IST12058G9
Vector VICTR76
Project tigm

Sequence tag IST12058G9HMF1
Sequence
GCTCGTGTCCTAGAGGCAAGGACGGTGGGTACTTAATAGAAAGAACAGCATGTATTTTAGTGGAAGCTTCAGTTACAGTT
CATGTCTTTCTATATTTCAGGTCATTTATTAAGTTATTGTTAAACTTTGAAATGTATCAGGAGTATAAGAAGCTTTCTCT
GTATCCTCTTCATAGTGCAGGGTGAGTAAGGAGGAATTACCAGCCACTCCCGCCACAGTCACATAATGCTTGCGTTCTGA
CTGTACGACATCTTATATTTCAGCCATGAGTCGGGTTTGCTTCCCCCAGGACCCCCGANTTCCTTCCTCTCTGCCTTCTT
TAGAGGTAGGATGGAGGCTGCCTGTTACCCATGCTTTGAAGAGAGGCTGAGCTACAGAGTGAATAAGCGCGTGGAGGAGG
GAGTCTCTGAGTGCNGTTTGTGCTCTTCCCCAGGGTCCTTCTTCATCANGACTCANTATTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97855229..97855694 458
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


Sequence tag IST12058G9BBF1
Sequence
GCTCGTGTCCTAGAGGCAAGGACGGTGGGTACTTAATAGAAAGAACAGCATGTATTTTAGTGGAAGCTTCAGTTACAGTT
CATGTCTTTCTATATTTCAGGTCATTTATTAAGTTATTGTTAAACTTTGAAATGTATCAGGAGTATAAGAAGCTTTCTCT
GTATCCTCTTCATAGTGCAGGGTGAGTAAGGAGGAATTACCAGCCACTCCCGCCACAGTCACATAATGCTTGCGTTCTGA
CTGTACGACATCTTATATTTCAGCCATGAGTCGGGTTTGCTTCCCCCAGGACCCCCGANTTCCTTCCTCTCTGCCTTCTT
TAGAGGTAGGATGGAGGCTGCCTGTTACCCATGCTTTGAANANAGGCTGANCTACAGAGTGAATAAGCGCGTGGAGGANG
GANTCTCTGANTGCAGTTTGTGCTCTTCCCCAGGGTCCTTCTTNATNANGACTCANTATTGTTAACAAGACAGTGTGTGT
TCTCAGACTTTTGTGTATACNTTTGTACTGATNCTNNTCATNNNTTTTGCNNTACNTATGAAN
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97855229..97855770 500
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es