Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14739B12
Clone ID IST14739B12
Vector VICTR76
Project tigm

Sequence tag IST14739B12HMR1
Sequence
AGTACAGACGCAGGCGCAAACATTAGATGCCGGCACAAACACGCACGGAGACAGAGACAGACACGAAACGACCG
Sequence Type genomic DNA
Unitrap ID UNI30769 UNI30770 UNI30882

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 133539966..133540039 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4627938..4628011 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60398622..60398695 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21905094..21905167 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 61009215..61009288 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003228 (Grk5) NM_018869 G protein-coupled receptor kinase 5 Gene [Source:MGI Symbol;Acc:MGI:109161]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 15950275..15950348 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 151986920..151986993 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054942 (C030011O14Rik) NM_174868 RIKEN cDNA C030011O14 gene Gene [Source:MGI Symbol;Acc:MGI:1924567]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15169069..15169142 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23721735..23721808 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73243256..73243329 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44405097..44405170 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62287629..62287702 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041729 (Coro2b) NM_175484 coronin, actin binding protein, 2B Gene [Source:MGI (curated);Acc:Coro2b-001]

 
Come back to gene ENSMUSG00000041729


For any suggestions or comments, please send an email to unitrap@crg.es