Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14542F5
Clone ID IST14542F5
Vector VICTR74
Project tigm

Sequence tag IST14542F5BBF1
Sequence
CATTCTCAAACCCTAGCCCAGGTGACAGTAATTTCTCTCTCAATTCTCCCCAGGGGCCTCAAGATTAACCAACTCTTCTG
GGTTTAGATCCAGGGACACAGTGGTTAAAACTTCTAACTACCCAAGCAGTGGTGGCGCACGCCTTTAGTCCCAGCACTTG
GGAGGCAGAGACAGGCGGAGTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACA
GAGAAACCCTGTCTCAAAAAACAAAAAATTAAAAATTAAAAAAAAATCCTTCTAACTATAAACCAGGAAGCCACATCAAG
ACACAGAAGCCAAGGGGTGGGAAATATGGCTCGGCAGTANAGAACTTACCTAAGTTATCCCTAGTCGCTCTTCCNGCCCC
CTCCCAAGTCAGAATCTAAACCTCNNGTNNGCCNTTCAATGGTCTGGAGGANGTCNNAGCACCTGTTTTATCNAAGCTGT
TTGTAAATCNGACTCGGGGTTGGAGGGCAACTCCCTAANGCNNANNANTCNNACTCTTCCAGANTNNAGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14542F5HMF1
Sequence
CATTCTCAAACCCTAGCCCAGGTGACAGTAATTTCTCTCTCAATTCTCCCCAGGGGCCTCAAGATTAACCAACTCTTCTG
GGTTTAGATCCAGGGACACAGTGGTTAAAACTTCTAACTACCCAAGCAGTGGTGGCGCACGCCTTTAGTCCCAGCACTTG
GGAGGCAGAGACAGGCGGAGTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACA
GAGAAACCCTGTCTCAAAAAACAAAAAATTAAAAATTAAAAAAAAATCCTTCTAACTATAAACCAGGAAGCCACATCAAG
ACACAGAAGCCAAGGGGTGGGAAATATGGCTCGGCAGTANAGAACTTACCTAAGTTATCCCTAGTCGCTCTTCCTGCCCC
CTCCCAAGTCAGAATCTAAACCTCAGGTCAGCCATTCAATGGTCTGGANGANGTCCAAGCACCTGTTTTATNNAAGCTGT
TTGTAAATCTGACTCGGGGTTGGAGGGCAACTCCCTAATGCNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87585095..87585618 512
 
EST/CDNA Est Name
  AW124157.1


Sequence tag IST14542F5HMR1
Sequence
ANGAAGCCTGTAAAAATGTTAGTCTCGGTTTCTTAGAGCTGGGGTAAATATTCTTAGTTCTGCATGGGAGATGGGTGGTC
ANGTANCCTGANACAAAGCCNGAGCCTGTGCCTGTTTGGGATCCAGGCAGCATTCTATCTAGGTCTGGTGAAGGTTGGGC
TCCCTGACAGCCAGGGCTGGGCTCTGTCANTTGATGTCCTCTGAATGCCCTGCTCTTGCTACACCATANANGANAACTTT
GACTGGCCNNCT
Sequence Type genomic DNA
Unitrap ID UNI21331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87585618..87585863 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008167 (Fbxw9) NM_026791 F-box and WD-40 domain protein 9 Gene [Source:MGI (curated);Acc:Fbxw9-001]

 
Come back to gene ENSMUSG00000008167


For any suggestions or comments, please send an email to unitrap@crg.es