Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13963D7
Clone ID IST13963D7
Vector VICTR74
Project tigm

Sequence tag IST13963D7HMF1
Sequence
GGGGGGAGGGTATAGGTATACACAGTCCTTGTTATTTAAATCAACTTAATTGAGGGCTGGGGAGACAGTTCANATGGTAA
AGTATGCCATGTAAAGTATGCCTGAGGACCCAATGCCCCAGTCANAAGGCANGAATGAAGGCATATGTTTATAATCCCAG
TACCGGGGAGTTANANACTGGGGCATGCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI31455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91983280..91983473 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es