Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST444616
Clone ID OST444616
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST444616
Sequence
ACTGAGGGAGCCCAGNTTCCCCTCTCCTTCTACCAGCCCTACCTTCTGGAATTACAGTCGTTCTGTGGGTGATTATGCAC
AAACCTTAAAGAAGTTTCAGTATCAGCTTGCCTGTAGATCACAGGCCCCATGTGCTAACAAAGATGAAGCCGATCTCATT
TCTAAGCAAGCTGCAGAAGAGGTCTGGGCAAGAGTGACTATGAATAGACAGCTTCTCGATCACATGGATTCATGGACAGC
CAAGTTTAGAAATNGGATCAGTGAGACNNTATNGGNGCCGNTTGNGCAAGAGATTGNGTCTGTCNNCACCCAGATGAGAA
GGATGGGCTGTCCAGAGCTACNAATANGANAGGCCGAGTTGTTACCAGCTTGAAGCAGAGCATGCCCTGGTCAGAGCTCC
TCTCATTNCAACTCTGAATGCACATTGTGCANTATTTAGACCTCACNCCACATCANGAGTACTTGTTTGAAAGAATCAAA
GAACTTTCTCAGGGGGGCTGTATGAGTTCATTCAGAT
Sequence Type mRNA
Unitrap ID UNI17340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30441149..30447995 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029782 (Tmem209) NM_178625 transmembrane protein 209 Gene [Source:MGI (curated);Acc:Tmem209-004]

 
Come back to gene ENSMUSG00000029782


For any suggestions or comments, please send an email to unitrap@crg.es