Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14721D1
Clone ID IST14721D1
Vector VICTR76
Project tigm

Sequence tag IST14721D1HMR1
Sequence
GGCCTGTGGAGGACATGGGGAGAANAAAAAGTTAAGGCAAAGATGGGTTGAGGTGGCGTAGAGCAGAGCTTGTGTTGGTT
AGGGAACGAAATCAGGGAGACAAGGGAGGAAACACTCATGGCTAGAAACTGGCGTTGTGTGTGAGGTTGAGAGAGCATTA
CTGAGCGCTGCCTANAAACCTCANGTGACCTTGAGGAAGAAACCATGTGAGTCAGGGCAGGGTCATGACTTGGATGGGTT
GAGATAATTGTTTCTCTGANAATTCTTTCACCTCANATATGTTTGTACCTTGATTTGGGCTTCTCANAAGCCCCCAATCA
GTANCANAAGCCTGTGGAAATCCTGTAATAATTCTGGAACGAATATNANNTACACTTCTCANTTTTTATGGTACNGTTN
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857402..97857799 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


Sequence tag IST14721D1BBF1
Sequence
GCCCTAAGTCCTAGATGCCCTAGACGTACCCAAACACTCACCTTCCTCTGAGAGCCAAGAAGTTGAGTGTGCCAATAATG
AAATAACTGAAAAGCTACTACTACCCAAAACTACGTGGTCCTCGGCAGTGCTCAGCAAGCCCTTTCTAGTCCCTGTAAAA
GATTTGCTTACAGTTGGGTAAGGCCCACCTCTGAGTTTGTAGGTGGATGGTTAAGGGTTTATTTTTAAAGATTTATTTAT
TTCATTTATGAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGCATCAGACCCCATTACAGATGGTTGTGAGCCA
CCATGTGGTTGCTGGGATTTGAACTCATGACCTCTGGAAGAGCAGTCAGTGCCCTTAACTGCTGAGCGATGCATCTCTCC
AGCCTGATGGTTAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97856986..97857404 419
 
EST/CDNA Est Name
  CX733968.1

 
Come back to gene CX733968.1


For any suggestions or comments, please send an email to unitrap@crg.es