Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13132G2
Clone ID IST13132G2
Vector VICTR74
Project tigm

Sequence tag IST13132G2HMF1
Sequence
CTANNNCNGNNNAGGGGANTCNNNNGNNCNNNNNANNNNNNNTNNTGCTANNAACCNNATCTGGGGTTTCAGCATGAACA
GCCAGTGCTCTTANCCACTGANCCATCTCTCCACCCTCCCTCCTTTTAAAGACAAGGTTTTTTTGTTTGTTTTGTTTTTT
TGGATTTTTGGTTTTTCAAGAAAGACAGGGTTTCTTGCCTCGAACTCANAAATCCNCCTACNTNTGCCTCCCAAGTGCTG
GGATTAAAGGGGTGCACCACCNNNATTTNATTTCATAGCTGCCTCCCTCCCACACACNCNNTNNNTANCCCNNACTGANT
TNNTACTTGAGGTCTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13132G2BBF1
Sequence
ATATCCCCAAGGACTGGAGTCATAGACTCCATCCCATCACGTGGGTGCTATGAACCAAATCTGGGGTTTCAGCATGAACA
GCCAGTGCTCTTAGCCACTGAGCCATCTCTCCACCCTCCCTCCTTTTANAGACAAGGTTTTTTTGTTTGTTTTGTTTTTT
TGGATTTTTGGTTTTTCAAGANAGACAGGGTTTCTTGCCTCGAACTCAGAAATCCGCCTACCTCTGCCTCCCAAGTGCTG
GGATTAAAGGGGTGCACCACCAANATTTTATTTCNTANCTGCCTCCCTCCCACACACGCACTAAGTAACCCAGACTGACT
TCNTACTTGAGGTCTCCCTGCTTGAGCCTCTGGANCACCTTCTGGGCCTGANCTACCNCCCTGCTCANTANCTGTGTGTC
TTGCAATAGTGTTCTCCNNNCCGGGCGTGGTGNCNAATGCN
Sequence Type genomic DNA
Unitrap ID UNI13754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77702176..77702615 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]

 
Come back to gene ENSMUSG00000017453


For any suggestions or comments, please send an email to unitrap@crg.es