Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12563F2
Clone ID IST12563F2
Vector VICTR76
Project tigm

Sequence tag IST12563F2HMF1
Sequence
CCTTCACCCTCCCCCATAGCCTTTCTCCACCCTCTCTGCCTCTGCCCACCCCAACAGAGCATTCAGCTGCCTTCCCTTCA
GCATGGAGGACAAATAGCCCCATTCAGGGGCACCCGCCAAANCTGTCTCTCTAANACAAAGCTGTGTGCAGCTCCCCGTG
AAAAACGGCTCTTGGCTGCCCAGCGAGCAGGCAGGATTGGTGGGTGCAGATTGCAGGGGATTTGTTAGTGGCTGCCAGTT
CCCCCAGANATAGCAGGAAGGCAAGGCCTTGTCCTTGAAACACCANCCTGCCTGGCAGGCTGGGGCACCTTCTCAAGGCC
NGGGACAGACTTCCTCCTGGACACCATCCCCACCCCCACCCNNATGTGAACTCNGCAGANCTGGGCTGTGGGGGANNNTT
GGCTTCCTTCN
Sequence Type genomic DNA
Unitrap ID UNI25435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26406963..26407373 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]


Sequence tag IST12563F2BBF1
Sequence
CCTTCACCCTCCCCCATAGCCTTTCTCCACCCTCTCTGCCTCTGCCCACCCCAACAGAGCATTCAGCTGCCTTCCCTTCA
NCATGGAGGACAAATAGCCCCNNNNNNGGGCACCCGCCANANCTGTCTCTCTAANACAAAGCTGTGTGCAGCTCCCCGTG
AAAAACGGCTCTTGGCTGCCCAGCGAGCAGGCAGGATTGGTGGGTGCANATTGCAGGGGATTTGTTAGTGGCTGCCAGTT
CCCCCAGANATAGCAGGAAGGCAAGGCCTTGTCCTTGAAACACCAGCCTGCCTGGCAGGCTGGGGCACCTTCTCAAGGCN
NGGGACAGACTTCCTCCTGGACACCATCCCCACCCCCACCCCCATGTGAACTCTGCNNNNCTGGGCTGTGGGGGANGGCT
TGGCTTCCNTCCNTCTGCCGGGCCTTCNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000007817


For any suggestions or comments, please send an email to unitrap@crg.es