Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11811F4
Clone ID IST11811F4
Vector VICTR76
Project tigm

Sequence tag IST11811F4BBF1
Sequence
ATAGTACCCACAGAAATGCCCACCGNAAGCTGCTCGTGCAAGACAGCCTCTTCCCCANATCTG
Sequence Type genomic DNA
Unitrap ID UNI20682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96625172..96625233 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]


Sequence tag IST11811F4HMF1
Sequence
ATAGTACCCACAGAAATGCCCACCGTAAGCTGCTCGTGCAAGACAGCCTCTTCCCCAGNTCTATGTTTCTCTGCATTTAG
CTCCCTCAGAGCCTGCTTCCTCCTTCCTTCTCTTCCTCTCTCCTTCCTTTCCTTCCTCCCTGGCCTCCCTCCATTCTTCC
CCCTTCTCTCCCTGCCTCCCTCCCTCCTGGTGTGTGGTCTGAGCTTCTTGACCATCCCCAGAGGATATTCTGACTGTCTG
AATTGCTCAGTCTGCAGAAAGGCAGGATAGGGGGCATGGTAACACTTANTCTGTTGTCTTCCTTGTGCTTCTTGCTCGCC
TCTTCCAGAAACTCAAACCAGACTCAGTTGCCCCAGGCAGGGCTCTTTTTCTCTCACTGAAGGAACTGGCCTGANAAGTT
GTTCCTTCTGGAGGTTGTCTGGGGGAGGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI20682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96624799..96625233 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es