Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12306E2
Clone ID IST12306E2
Vector VICTR76
Project tigm

Sequence tag IST12306E2HMF1
Sequence
GAACAGACAAGCCTCCTGGCTGCCTACCCTGGAGAAAGGAGATTCAGGTCCCCAGGAGTTATGACTGTCTGCCCTCAGGT
CCAGAGGGAAAGCACATCGGTATCTTTTCCAGATGAGTCTTTTGTGAAGTGGCCTATCCGTCTTCAACTTCCTGTTTCTT
TTCCCTTGGCCTGTAGTATGATGGTTCAAGACCTTTTGAGGTGACAGAAACTCTAGAAACCTGGGGTGAAAGGTGAGGTA
GCGTGTGGGCTTCTAAAATGACAGACTAGGAGCAGAAATGGGGTACTTGGGGCTCCCCTANANCACTGTGCACGTGCACA
CACACACAAACACACACACATCGCNNNACGTGGAGGTAGAAACGCAGACTCCAGTNNNNANGGANTGCTNCNNNNNAAGT
ACCTGCTGTGAAANTTNNNNTCTCANANCCCNCTGTGAAAAGNCTNNGNATGGANCTTNCNGNCNNTCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12306E2BBF1
Sequence
GAACAGACAAGCCTCCTGGCTGCCTACCCTGGAGAAAGGAGATTCAGGTCCCCAGGAGTTATGACTGTCTGCCCTCAGGT
CCAGAGGGAAAGCACATCGGTATCTTTTCCAGATGAGTCTTTTGTGAAGTGGCCTATCCGTCTTCAACTTCCTGTTTCTT
TTCCCTTGGCCTGTAGTATGATGGTTCAAGACCTTTTGAGGTGACAGAAACTCTAGAAACCTGGGGTGAAAGGTGAGGTA
GCGTGTGGGCTTCTAAAATGACAGACTAGGAGCAGAAATGGGGTACTTGGGGCTCCCCTAGAGCACTGTGCACGTGCACA
CACACACAAACACACACACATCGCANGACGTGGAGGTAGAAACGCAGACTCCAGTGGGGAGGGATTGCTCCGTCTGAAGT
ACCTGCTGTGAAAGTTGGATTCNNNNNNNNCCCTGTGAAAAGGCTAGGGATGGAGCTTCCTGCCTTTCTTCNTCATGCTG
ANGANGCNGTGACCAGCAGANCCCNGGTGTTTGCTCNGCNNGCANNCTAN
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22409721..22410249 489
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es