Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11668H6
Clone ID IST11668H6
Vector VICTR76
Project tigm

Sequence tag IST11668H6HMR1
Sequence
TATAAGAGATTATTTTATACATAGGTGTGAGCTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58093640..58093673 34
NO GENE  


Sequence tag IST11668H6BBF1
Sequence
ATATGATCTTTGGTCTTTTAATATGATGAATTAAAATCNGTGTCTTTTCTTTGAACTANATTTTGGTTCCTAGGAGGAAA
AACTCAACTTGAATTATGAAAATTAATTAATTAATTATTAATTTTGTTCCTANCTGGGTTATGTTTTGAAATATTTTAAT
TANGCTACTCTCTGAAACAATAAGTACAATCAATTTCTAATGTAGTTTGTATGGGCTTTGCATTAGGTTTNCCTGTCTGC
TTTATACTCTATATCTCTTTAATTTGAAATCTTCCATTTTTTTGAGCATGATAATGCANNTNTNCATCTTAATAGAGGAG
ATGATTGACACCNCCTNCCTNNNNNCATCACCACAGANAANTGATCGGCTTTCCACAAATGCTAAGCCACTTCAAGATTA
CTCATAAGTCANGATGCCTTCNNNACTAGCATTGGGGTANCAGANGCNNNCNNATTTTTGTGANTTTGANGACACTCTAN
TCTACACAGCAAGTTCTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11668H6HMF1
Sequence
ATATGATCTTTGGTCTTTTAATATGATGAATTAAAATCANTGTCTTTTCTTTGANCTNNATTTTGGTTCCTANGAGGAAA
AACTCAACTTGAATTATGAAAATTAATTAATTAATTATTAATTTTGTTCCTN
Sequence Type genomic DNA
Unitrap ID UNI7564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58093512..58093642 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es