Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13211H6
Clone ID IST13211H6
Vector VICTR74
Project tigm

Sequence tag IST13211H6BBF1
Sequence
GCTGGAGTTGTAGGTTTGCACTACCACATGTGGGTACACCCGTAAGTTTCCCCAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35018350..35018410 61
NO GENE  


Sequence tag IST13211H6HMF1
Sequence
AATTGAACCCAGGTCCTCTGGAANAGCAGCCAGTGCTCTTAACAGAANAGCCATTTCCCCCAGCACCTGTCTTTTTCAAG
AAAGAGTTTCACTTTACAGGCCTGGCTGTCATGTTTAAGGTCGGGCTGTAAACCTGCCTGCATTCTGTATGTCTTANCTT
GTTCGAATGTCCTGTCACTCTGCAGGTTAANACCTGGTTTCAAAACCAAAGGATGAAGTGCAAGCGGTGGCANAAAAACC
AGTGGTTGAAGACTAGCAGTGGTCTGATTCAGGTAACAAGATGTTTTCTCTGCTTTCCTTTTTCCCCCTCCATCTTACCA
TCTTATTTTATGTGTCTGTGCCGTGTGTGTGTGTGTGTGTGTGTGTGTGNNNGAN
Sequence Type genomic DNA
Unitrap ID UNI31662

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122662462..122662830 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012396 (Nanog) NM_028016 Nanog homeobox Gene [Source:MGI (curated);Acc:Nanog-003]

 
Come back to gene ENSMUSG00000012396


For any suggestions or comments, please send an email to unitrap@crg.es