Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10462D2
Clone ID IST10462D2
Vector VICTR76
Project tigm

Sequence tag IST10462D2HMR1
Sequence
CGTACACCTTGACTGTACTCCTGGGGGAGGCAGAGGCAGGTGGATCTGAACTCCAGGCCAGCCTGGTCTGCATAGTGGTG
TCNACCCGGCTTCCTAAAGAAAGAAAGTGCTACAATGTTGGCTTTATTTGGTGTCTTGTTGCCAGTANCCTCTTGGATCT
GTCTTAAGAGCAGAGAGCANAGTTCTGTTGATAAAAACTCACTGCCTCTCCCCTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71602496..71602713 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032232 (Cgnl1) NM_026599 cingulin-like 1 Gene [Source:MGI (curated);Acc:Cgnl1-003]

 
Come back to gene ENSMUSG00000032232


For any suggestions or comments, please send an email to unitrap@crg.es