Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10024A9
Clone ID IST10024A9
Vector VICTR75
Project tigm

Sequence tag IST10024A9BBF1
Sequence
TATCTATCTATGTGGTTGCTCAAAACAAGAATTAAAAAGGGAATGCAGGGCATGTGGACAAAAATCTATATACTCTCAGC
ACGCCAGAGGTTGGGACAGAAGAATCCAAAGTTCAAAGCCATCTTTGGCTATATATGGAGTTTGAAGTCACTCTGAGCAA
CATAAAACCTTGTTTCAAACCCAAAACACACGCACATCAAAGCAACCCTCAGCATTCGGTGCCTGCAACTCCAACTCTTA
AAAGTTGAGAAGGTTCAAGAGTTCAAGGCCAACCTGGGCTACAAGCTATCTCTCCCTTTCCCTTCCAAGGCTTGCTAATT
CTACCTCCAAACGCTCATCTTTTCACTCTGTCTACTTCCATTTGCAAGGAGTCAATCCAGGCTACCGCAGAAGGCTGCAT
CCTGACTCCTCAGCACCCCCCCCACACACACACACACACACTTGTGACTTCTCCGGTGTAGTGGTGGGATTGCGCCACTA
CCCTTCTCAAAACCTTTCTACGAGCTTCCTATAAAAAGTAAGTCTGCCAGATGTGGTGGGTGGTGGAACCACACCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20142215..20142767 543
NO GENE  


Sequence tag IST10024A9BBR1
Sequence
GATAACTGTACCATTTATTGAGATGGGGCAAGCATGCACCACCACCACCCGGCCTCAATCTGTTTTACATGAGTTAAATC
TGAGTGACATATTTGTTATACGGTCAGTATGTTGAGAAAGCACATGTGACAGTATAAAAGTCAGGATTAAAAGACTAAGC
AAAGGACCGAGGAGAAACAGAATATGTATTTTCTCTTTGGAAACCAGGACGGCTTATAAGCTACTAGAGTAGGAGTTGCT
CCTTTTGCACTGGTGAAATGGCCTTAGTTCCATTCCCAGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI36255

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20142764..20143047 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]

 
Come back to gene ENSMUSG00000041215


For any suggestions or comments, please send an email to unitrap@crg.es