Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14337E12
Clone ID IST14337E12
Vector VICTR74
Project tigm

Sequence tag IST14337E12BBF1
Sequence
TAANTACACNANANCTGNNNNNANACNCNCCNNTAGAGGGTGTGAGATCCCATTATAGATGGTTGTAAGTCACCATGTGT
ATTTGAACTCANGACCTTCATAAGAACAGTCNAGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCCCTAAAAATATTTT
TAAAATTAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14337E12HMF2
Sequence
TAAGTACACTATAGCTGTCTTTANACACACCAGTAGAGGGTGTGAGATCCCATTATAGATGGTTGTAAGTCACCATGTGT
ATTTGAACTCAGGACCTTCATAAGAACAGTCAAGTGCTCTTAACCNCTGAGCCATCTCTCCAGCCCCCTAAAAATATTTT
TAAAATTAAAAAAAAAAAAANNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100599719..100599898 176
NO GENE  


Sequence tag IST14337E12HMR1
Sequence
GCATGACTGTAANAGATGGTCCATGGGAAAAGTAATAGTGGTATTGGTATTAAAAAAAAATTGGATGGGGGATGCACAGG
ATGGGTACATANTANATTTCCTCTCCCAACTACCTACTTATCAGTCCTTACACACTCTTTGCTGAACCTGACTTTTCATG
TGATGTTTTANTTTTGTCAAATACTGATCAATGGCTGGAACCATTTAATTTGTCTGGTACAACATGTAATTATTATTCCT
ANCANCTCANGAGGTGGCN
Sequence Type genomic DNA
Unitrap ID UNI23348

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112247390..112247647 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es