Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14841F7
Clone ID IST14841F7
Vector VICTR76
Project tigm

Sequence tag IST14841F7HMF1
Sequence
AGTCATATGTATAATATAAAGACACTGCTCACANCAAAAGTGGAATANAAACTATACTTCNAGCTAATCANCCTTCANTG
GTCTCCAAGGTNNNCAACATCANCACCATACTGANCCNCTGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14841F7BBF1
Sequence
AGTCATATGTATAATATAAAGACACTGCTCACAGCAAAAGTGGAATAGAAACTATACTTCAAGCTAATCAGCCTTCAGTG
GTCTCCAAGGTTACCGACATCAGCACCATACTGAGCCTCTGATCAGTACCCATCATATTCAGAATACAGAGGACCCCAAA
GGGCAAACAGCTTAGATCATACTCACACCAATTATATTTGGATGACTTAGTTCCTGTAAGAGCTTTATCTCCCTTAAGGC
TGTTCTATTTATTCCTATAGAAAAAGAATATAAAAAATGAACAAAANTTCTGATATATCAAACCTTTTACAAATGTATTT
TTTTAAAAGGTCATTCANAAAAATACACNNTNNACATNCNCANNANGAATAACNTNANCTATTTTNANGAGAANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14841F7HMR1
Sequence
GACTGAGGAAAGGAGTCAGATGTTTCCATACAGGCTAATTTTGTCAGAAATGATTTTGTATCCATTGGTTAAAGGTAGCA
GCTTACATTTAAATTGAGAACCTTTTTGCCTGTGTGTGGGCTGCGTGTGTTTCGGTTAAGTTACTGTAATTTGTGTACTG
GAAATGCAAGTGTGTATCCTGTACCTGGCAAGACGCTTCTTACCAATTTTGCTGAGGAATTTTTGTTTGATTTTGTTTTC
TTCAAGACAGGGTTTCTCTGTGTANCCCTGACTGGCCTTGAATTCAAGGATTTGTTTGCTTCTGTCTCCCAAGTGCTGGG
ACCAAAAGCATGTGTCACCNTGCNTGACAAGATTTTTTTTTNGGTTTTNNAANNNNGGGTTTCNCNGTGTANCCCTGGCT
GTN
Sequence Type genomic DNA
Unitrap ID UNI17546

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101489957..101490358 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]

 
Come back to gene ENSMUSG00000069089


For any suggestions or comments, please send an email to unitrap@crg.es