Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14231C7
Clone ID IST14231C7
Vector VICTR74
Project tigm

Sequence tag IST14231C7HMF1
Sequence
CAGTGAAGACATCAGAAGTTCACTGTCATGTTATAAAACTGACAACAGCCACGTGCAGTGCGTTCCCAGCATTCCACATC
TAATTAGGTTATGGTAGTAAGACCTTTGGCATGGTGATATACTTTGCCAGCCCTGATTCACACACACACAAAAAAACAAC
AACTAAAAGAAACCATGAAATCTCAAAGATTAATAAGAAAGAAGCTACGTGGTTAGAAGAAATGTTTTACAGGTGCCACT
AATTATAAACCACAAAAACCTTTCTGGAAGGTTACTGGTTTGGAGCATAACTCAAAAGCATCTGCAAACTAAATACAGAT
GGAGCACATTTTAACCCTGATGCCAGGTGGCCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59536856..59537208 353
NO GENE  


Sequence tag IST14231C7HMR1
Sequence
NTGAACATTATAAAGCATTCCNTGTGTCTCTACTGCTGTTCCCCACCACATGTCTATTCATAGGAAACTAACATAGATCT
ATGGCGCTTCAGGTTATCCTAAGGGATCTTTTCTGAGCCTGGATTACACATTCGGTCAATATGCAAACGACATTCCCCAT
TTTTTTCCCTACATTTGACTCTTTTTCTTTTCTCCTTANANACAAAAGACTGTTGAAAATGCTGAAGGCTGTGCTGAANA
ANANCCGANAGGGAGGAAAGGGAAGCAAGAAGGAAGCAGGTACGTGCACCGAGCAGGTATTATGGTGGGCANNGCAGGGC
ACCCAGATCCCACTGCCTCAGGCTGGGTGGTGCANACAGGCTCNNCACGAACAGCATCCTGGAAGCCGTGAAGGGTCTGT
ACTCTGAGTGGTATGTGTGTGTGTGTGTGTANGGGTGTTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59537207..59537648 416
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es