Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10874D10
Clone ID IST10874D10
Vector VICTR76
Project tigm

Sequence tag IST10874D10HMR1
Sequence
ATAATTGGCAAAACTAAAAATATTGTTTGATTAAAAAAAAATGGTCANAGTGTTGTGATTTCCTGGCATTTGTTGTTCTT
CATAACCCAGTCAGCAGCTGAATGCCTCCCCACCCGCTTTGTAACAATATGAGCTTCTTANCCTGGCCCTTTAATANATG
AAATGAACTTCAACAGATTAATTGTATTGTGACAGTATATGTGCCCAAGGAGGGAATTTCTTGAATCCGGGCAACTGTGG
ACCTCAAAAGGGAAANAANTANTGGTTGCAGTTTAACATGTGCGCTGTCTCTGCTTTTGTCTCACTAGGGAAACCACTTT
CAGGCCAATGTGTCAAATATCTGTAACTGGAGTTACAGACAGTTGTGAGCTGCCGTGTGGGTGCTGGGAATTGAACCCAG
GTCCTCTGGAANANAGCAGCTAGTGCTCTTAACCNCTGAGCNNTCTCTCCAGCTCTCTGAGTATACACGTTTTTGAACAC
AGGGACATGTGCNTCACTAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI29812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93242499..93243001 475
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]


Sequence tag IST10874D10BBF1
Sequence
ATACCAGTCATTCTCCTGTTTCAGTATTCCAAGCAGCTAGGACTAAAATCTATAAAACTGGGCCTATGTTTTTGACCAGT
TTTAATTATGGTGATGGCTTCAATTTTTTTCAAGATGAGCAATACATTGTATATAAAATCTATCTCAATAAAGAAGGTTT
TTAAAGGTCTTTGATTTTAATTTTTAACTGTTTTCTAATTGTCTGGCGTGTTAACAAATACAGGCATTTTGTTCAATTGT
ATTTACAAACTACGTGATCAACATTTTAACCTAAATTTCTCCACTTTCTGTCTCTTTCTCCTATCAGAGTCTNCCAGCAA
TCAAGCCNCCATGTATTAGGAATCTCTTCANCAATTCTAATAGCTGTTNNNTAAAGATTCNTCTCCGGGCACTAATGCAA
TCAACATAATTATAATAACNCATGTGACATACTAGCATGANAATCAGTGGTGATCCTGTCATTCCCGTGCNGATNTTGCN
NATAAAACACTGTGTTCTCTTCTCTAGATAANGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 93836712..93837228 489
 
EST/CDNA Est Name
  BQ770362.1 - CJ124449.1 - BG295383.1 - CF540127.1 - CF540063.1 - CF726757.1 - BQ745808.1 - BB660518.1 - BB648748.1 - CJ122235.1 - CJ112986.1 - CJ133757.1 - BY122918.1 - BY125963.1 - CF536010.1 - BX524490.1 - AA759600.1 - CJ065562.1

 
Come back to gene BQ770362.1 - CJ124449.1 - BG295383.1 - CF540127.1 - CF540063.1 - CF726757.1 - BQ745808.1 - BB660518.1 - BB648748.1 - CJ122235.1 - CJ112986.1 - CJ133757.1 - BY122918.1 - BY125963.1 - CF536010.1 - BX524490.1 - AA759600.1 - CJ065562.1


For any suggestions or comments, please send an email to unitrap@crg.es