Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14935D12
Clone ID IST14935D12
Vector VICTR76
Project tigm

Sequence tag IST14935D12HMR1
Sequence
ATAGTAANNGAANANNCCCAAACTGAANNAANGNGNGNCACAATCTGTTTTTAAAACCGTATGTGCTTACGGGCACCAGC
AAAATGCCTCAGCAGGTAAAGGCATCTGCCTCCCAAGCCCGCCGACCGGGGCTCAACCCCAAGACTCACAGGGTCGAAGA
AGGGAACTGATAGAGACACAGAGCATTCAGGACCACGTGGGCACAGTGAGTTCATGGACACAGAAGGCAGCAAACCTTAA
ATCCCTACAAACTGGCAAGTATCAAACCTGATGGCACGTCAAGCAATGCCAACATCATAAAGGTCATCTGTGATGATAGG
AAGGCAACATGTANANNCACAGCTGCTGCTCGGNNGTGGGTCTGCCAAGTGTTCTACTCTTTCTCTGTCCCTAAGTTTCC
ACAGANAACAGTGGCCCGCCTTTCCTAGCACATTGTCACTGANGGCTGCTNTTATGTCCAGCCCANGGCTNATTGTCTCA
NGCTGANCTGANTTCTTGTGTTANGNTACANCTGGCTTNNNTGCCNANGCCNTCACNNNACATCNNNGGCTCACCNNNTT
NCCNACTNNGGCATNTNTNANCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14935D12BBF1
Sequence
CTATTTGAGAGTGCATCACTGTATCTCACAATATCCCTTAAAAACATGGTTTTTAAATAACTACATTGTCAAATGAAGGC
ACCAAATTCACTCANCCTATTATTTTTTCCTTAGGAATTTATGTAAGCATAGGACTTCCTCTGTTATAAATAATACGGAC
GGGCATCCAANAATATGCCTGTGTGATCCCTTTACTCANCAGGATCAAGTCCAANATGTNAAATTCCTGGCTCACTGGTT
GTATCCCCTGANCN
Sequence Type genomic DNA
Unitrap ID UNI8136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28082931..28083181 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es