Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12137B3
Clone ID IST12137B3
Vector VICTR76
Project tigm

Sequence tag IST12137B3HMF1
Sequence
AAACCAGCCTGGGCTATATGAGATCCTTTTTTTTCAACACAACAAATGCATAGCTCAGCCCACATTTGGCTTTCTTTTTT
GTGCAGTTTAATTATAATAACATAGTGGGGTCCTTATTACTCTCTTATCTCTGCTCACCCCCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI14371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 65390128..65390276 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057182 (Scn3a) NP_061202 sodium channel, voltage-gated, type III, alpha Gene [Source:MGI (curated);Acc:Scn3a-001]

 
Come back to gene ENSMUSG00000057182


For any suggestions or comments, please send an email to unitrap@crg.es