Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11782E9
Clone ID IST11782E9
Vector VICTR76
Project tigm

Sequence tag IST11782E9BBF1
Sequence
GTCCTTCGTGGGCCAGCTCTTCAGCCAACACCCCGATGTCTTCTACCTGATGGAGCCGGCTTGGCACGTCTGGGATACGT
TGTCGCAGGGCAGTGCCCCCGCACTCCACATGGCCGTGCGTGACCTGATCCGCTCAGTGTTCCTATGCGACATGGACGTA
TTTGATGCCTACCTGCCCTGGCGCCGCAACATCTCGGATCTCTTCCAGTGGGCGGTGAGCCGCGCATTGTGCTCACCTCC
GGTCTGCGAAGCCTTCGCTCGTGGCAACATCAGCAGCGAGGAGGTGTGTAAGCCTCTGTGCGCAACGCGGCCCTTCGGCC
TGGCTCAGGAAGCCTGCAGCTCCTATAGTCNCGTCGTGCTCAAGGAGGTGCGCTTCTTTAACCTACAGGTGCTCTACCCG
CTGCTCAGCGACCCTGCGCTCAACCTGCGCATCGTGCACCTAGTGCGCGANNCGCGGGCCGTGCTGCGCTCCCGANANCA
GACAGCCNANGCGCTGGCACGGGACAATGGCATCGTCCTGGGTACNNACGGCACGTGGGTGGN
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114414187..114414728 524
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es