Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14979B6
Clone ID IST14979B6
Vector VICTR76
Project tigm

Sequence tag IST14979B6BBF1
Sequence
GTCTGGAGCTGCTGGGCTTCTACACTGAGTGTGTGCAATCATGCAGCTTTCGTAGCCTTTGTATGGTGGAAAATGGTCAG
GTTTGCATGCTCTTGCTAAGGTTGTTGTTTTCTTCACAATACAGACGAGCAAACCCATAAAACCTGTATCTAATTCTTGG
CTTTGTTTCTCCTCACAAGAACAGCTTATGAAATTCTAAAATTTGTGTACTAAGATGTTTGTTGTTTAAGATTAGTCTAA
AGTTTCAGCAATGAAGGCAGTAGGAGAATCTCCTATTAGGACAGAAATGTCCTGGCAATTCAGGTGGAAAAGGGTAGAGT
CGTTGATGAAATGTGCTGGACNAAGAANATCGCTTTACAGGGAAATGAAAGTCTCCATGCATGCAGATTGCATTCACCAC
GGNNCTGANATTCAAATGGGAGGGTTTGGAGCATANCCGTGCTGCACACGCTCCN
Sequence Type genomic DNA
Unitrap ID UNI23144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135217903..135218356 442
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST14979B6HMF1
Sequence
GTCTGGAGCTGCTGGGCTTCTACACTGANTGTGTGCANTCATGCNNCTTTNGTANCCTTTGTATGGTGGAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es