Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14334C6
Clone ID IST14334C6
Vector VICTR74
Project tigm

Sequence tag IST14334C6BBF1
Sequence
CTTACTTTCAAAGTAAACTCATCTTGATCTCATCANAATGCTTCTGTTGCATAAAGAAATGAGGAAAAGTCATTTCCATC
TANAGTGGAAAGCTTGCCTTTGTATTTATTGCCACTACACCANCATTTTCCCCCTTAGTTTTTTAAACANACATCANGGT
ANCTTTAATGTTGGGAGAGGAGTTGGCCTGGGAAGAAGCCCTTTGAGCAGGATCTCCACTGTTCTGCATTGCTCAGATGT
GATATATTTGATCANTGTANTANCTGGGANCTTGGGATAATTTAATAATGGGGGTCGTTAATCTTGCAAGCCTTTGANCC
CTGAATTTACNACTTTAACTTTACATATCTGCTTACTTTTGCATTNAAATTN
Sequence Type genomic DNA
Unitrap ID UNI12508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4710671..4711041 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]


Sequence tag IST14334C6HMF2
Sequence
CTTACTTTCAAAGTAAACTCATCTTGATCTCATCAGAATGCTTCTGTTGCATAAAGAAATGAGGAAAAGTCATTTCCATC
TAGAGTGGAAAGCTTGCCTTTGTATTTATTGCCACTACACCAGCATTTTCCCCCTTAGTTTTTTAAACAGACATCAAGGT
ANCTTTAATGTTGGGAGAGGAGTTGGCCTGGGAAGAAGCCCTTTGAGCAGGATCTCCACTGTTCTGCATTGCTCAGATGT
GATATATTTGATCAGTGTAGTANCTGGGAGCTTGGGATAATTTAATAATGGGGGTCGTTAATCTTGCAAGCCTTTGAGCC
CTGAATTTACAACTTTAACTTTACATATCTGCTTACTTTTGCATTAAAATTGGGTTGGCNNGC
Sequence Type genomic DNA
Unitrap ID UNI12508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4710663..4711041 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es