Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14685A3
Clone ID IST14685A3
Vector VICTR76
Project tigm

Sequence tag IST14685A3HMF1
Sequence
CTCCAAACATTTCCCTTTTGTTTATTCTAGGAATCGTTGGGCCTACACAGCAGAGAGTAGTATAATAGAGTCGCACATGC
GGGCCACCTGCCCTGATGAACTGTGTCATAGCTGACTGTTTTTCTCCACTCAGTTCCATAGCCACACACTTGATTGTTTT
CTCTGTCTTAAAGGAAGTTCTAGATGCCCTATCGTTCATTCCACAAATAACCCCCAGGTACTCAAATGCGATACAGACAC
GTTTTTCTTGGAANCTTCTTCCNAAGAAGGCCGTCACTTGCAGGTTTTTACCAGANGGGTCCTCCCACCANCAGGANTCT
GN
Sequence Type genomic DNA
Unitrap ID UNI8136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28103894..28104214 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]


Sequence tag IST14685A3HMR1
Sequence
GGAGGATCCATTTTAAGTTGTGCTAACGCGAGCTCTGGTCTTGGGCAATTCATTTCATTCCTTGGGCCCTCAGTTTCCCC
AGCTGTGCGGTGACTTGAATGTCTTCTGAAGATAGCTTTTTAAAGACTAAATGGTAAGATAAGATATACACAAAGGGCCC
GGAACTATAATAACAGTAATAACACCTCTCTCTGCCATGAAAACACGGCAGAGCTTGACCNTAGGTAGCGTATGATTTTT
TTCCTCTAAGGCAAGCCATTCNNGGCANCCCTGGAATGGGCNACCTANGANCCCANAACTGANCAATTACCATCNAGCCC
TCCCAGCNCCNTTGANGTACCTATGGCTTTTCTGAAAGCTGAACTCAATACTAATTATTATNNNCANGCCTCCAGTTCTT
TCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14685A3BBF1
Sequence
CTCCAAACATTTCCCTTTTGTTTATTCTAGGAATCGTTGGGCCTACACAGCAGAGAGTAGTATAATAGAGTCGCACATGC
GGGCCACCTGCCCTGATGAACTGTGTCATAGCTGACTGTTTTTCTCCACTCAGTTCCATAGCCACACACTTGATTGTTTT
CTCTGTCTTAAAGGAAGTTCTAGATGCCCTATCGTTCATTCCACAAATAACCCCCAGGTACTCAAATGCGATACAGACAC
GTTTTTCTTGGAAGCTTCTTCCAAAGAAGGCCGTCACTTGCAGGTTTTTACCAGAGGGGTCCTCCCACCAGCAGGAGTCT
GGGTTGCCCTTTGCGCATGCCTGTGGGTCCTATGGTGGTGTGTGTCACTGTGTGGGGCTCTCTGGTNCCNCNNAAGGTCC
TCCANGN
Sequence Type genomic DNA
Unitrap ID UNI8136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28103894..28104297 396
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es