Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14252F2
Clone ID IST14252F2
Vector VICTR74
Project tigm

Sequence tag IST14252F2BBF1
Sequence
NNNNNNNGTGGATNNNNNNNANNNNNANNNNNNNNNNNGANTNANTNNNNGTNNNAAGTTAGTTTTTAAAAACTAAAACA
CATAAGCAACTATAATTAGTAGTCNTATATAGTACAAATACAACTATCAATAATACTCAAGTTTTCCAAGAAAATACCCA
GAAATAATTTTAAAATCAAAGCAATTGCTGTATTAAGATATTCCACAGNCACCTAGTTGTANGAAGGTAGTTNAAATAGT
NNNANTCNAACATACATGAGAAATTGATTCCNCAACTAATCTATACATGGTTTGCCNTGAAACTCATTCAATTGCTGAAA
ATATATTTTCTATTTGCCTATATACAGTATCTGGATAGTTTNACCTTGTAGAGAAAAAAATCACTGATCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 44687277..44687610 310
 
EST/CDNA Est Name
  BY268275.1 - CN684987.1 - BY280006.1 - BB870789.1 - BY093860.1 - BY130250.1 - BY292143.1 - BY134819.1 - BY147884.1 - BY141521.1 - BY035102.1 - BY139574.1 - BB869830.1


Sequence tag IST14252F2HMR1
Sequence
NNTTACTGTTACAATTTTTACAGCTACAACAGCTGTAACTGCTAGAGGAGACAAAAAATGTANTTCACCTTGAAAATAAT
CATGGCTCAGGGAAGAAAGAAATTGGGTCAAGCTTAAAATAGATGCAGGTGCAGTGGCAAAAACTTTTAATAAAAAATTT
AAAATATTCCTANCNCTGNATTCAANCTCCTTTTGTTCTCTGGTGGTGATGCATTGTTAGAGTGAGGCTGAGCTGGTGCT
TCCCACANTGNCCN
Sequence Type genomic DNA
Unitrap ID UNI24250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 44686976..44687226 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036890 (Gtdc1) NP_766250 glycosyltransferase-like domain containing 1 Gene [Source:MGI (curated);Acc:Gtdc1-001]


Sequence tag IST14252F2HMF1
Sequence
GTAAAGAGTAGAAATCTGCACATGAGATGCATTCCCTGAATGAATAAATGTATTAAGTTAGTTTTTAAAAACTAAAACAC
ATAAGCAACTATAATTAGTAGTCATATATAGTACAAATACAACTATCAATAATACTCAAGTTTTCCAAGAAAATACCCAG
AAATAATTTTAAAATCAAAGCAATTGCTGTATTAAGATATTCCACAGACACCTAGTTGTAGGAAGGTAGTTTAAATAGTT
TTAATCAAACATACATGAGAAATTGATTCCACAACTAATCTATACATGGTTTGCCATGAAACTCATTCAATTGCTGAAAA
TATATTTTCTATTTGCCTATATACAGTATCTGGATAGTTTTACCTTGTANAGAAAAAAATCACTGATCTCAGGTTTAAGT
TACAGAAGANGTAGTTTAAGTANACTGTCCCTAAAAGTTCANANGTTTACCANGAGTTTCTTTTACTGAGCCTTTCTCTT
CCTCACNTGANTTTCCACTGAAGANNNNNTCACACTNNNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 44687223..44687738 490
 
EST/CDNA Est Name
  BU707427.1 - DN175632.1 - DV654629.1 - BB617242.1 - BB612255.1 - BY733295.1 - CN689161.1 - CN689872.1 - BY268275.1 - CN684987.1 - BY280006.1 - BB870789.1 - BY093860.1 - BY130250.1 - BY292143.1 - BY134819.1 - BB651489.1 - BB631406.1 - BY147884.1 - BY141521

 
Come back to gene BU707427.1 - DN175632.1 - DV654629.1 - BB617242.1 - BB612255.1 - BY733295.1 - CN689161.1 - CN689872.1 - BY268275.1 - CN684987.1 - BY280006.1 - BB870789.1 - BY093860.1 - BY130250.1 - BY292143.1 - BY134819.1 - BB651489.1 - BB631406.1 - BY147884.1 - BY141521


For any suggestions or comments, please send an email to unitrap@crg.es