Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AB0249
Clone ID AB0249
Vector pGT0lxr
Project sanger

Sequence tag AB0249
Sequence
GATTATGAGTATNTACGGACCCTCTTCACAGATCTGTTTGAACGGAAAGGCTATACCTTTGACTATGCCTATGATTGGGT
TGGAAGGCCTATTCCTACTCCAGTAGGATCAGTTCATGTAGATTCTGGTGCATCTGCAATAACTCGAGAAAGCCACACAC
ACAGGGATCGGCCATCACAACAACAGCCTCTTAGAAATCAGACTACATCATCAGAGCGCCGAGGAGAGTGGGAAATCCAG
CCCAGCCGGCAGACCAATACCTCATACCTGACGTCTCATTTGGCCGCAGACCGCCATGGGGGTTCAGTACAG
Sequence Type mRNA
Unitrap ID UNI3335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65858285..65867719 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032384 (Csnk1g1) NM_173185 casein kinase 1, gamma 1 Gene [Source:MGI (curated);Acc:Csnk1g1-001]

 
Come back to gene ENSMUSG00000032384


For any suggestions or comments, please send an email to unitrap@crg.es