Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12270C3
Clone ID IST12270C3
Vector VICTR76
Project tigm

Sequence tag IST12270C3BBF1
Sequence
NNATGTTGCGTAAACNTGANCTTTGGGTCGTTCAACCAACTTCTGGANANGCTGTAAAGCTTTTCCATGACTTTTGCTCT
CTATCCTTGTCCTGGCTGGGCCAACGTCNCGCTCNNCNNCNNACCCAANCTCGTCNCTTTGAANCGGGTCANGCTGTCCC
NCCCCCCCATGTCCCGCAAAAGCAAAAAGGCANGGAANCNCCNCTTTTCTTTCTAGCTCCTGCNTCCGTGGGGCCGGCGG
GGCGCCCGGGGGAANAACGGNCGGNCNNACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12270C3HMF1
Sequence
CCATGTTGCGTAAACGTGACCTTTGGGTCGTTCAACCAACTTCTGGAGAGGCTGTAAAGCTTTTCCATGACNTTTGCTCT
CTATCCTTGTCCTGGCTGGGCCAACGTCGCGCTCGGCAGCAGACCCAAGCTCGTCGCTTTGAAGCGGGTCAGGCTGTCCC
GCCCCCCCATGTCCCGCAAAAGCGAAAAGGCAGGGAAGCGCCGCTTTTCTTTCTAGCTCCTGCATCCGTGGGGCCGGCGG
GGCGCCCGGGGGAAGAACGGGCGGTCGTACAGCCAGCAGACTCCAGACCCGCTCTGCACTCGCCCCGGGCCGGCAGCGGG
AAGCGACGCCTCCCCCCAATAACGGCTTCAACCGCCTCCTGCCAAGTCCCCGCTCTGGCCTCCAAANTCGCGGCCCAAAC
ACCTCACACTCACTGGTAAGTGGGGCCGGGGGCCCGGANCCCGGCCCGGGGCCGGCCCCGGGAATTCTGCGAGACTCCCA
NGGTTTGGGGGGGCGGCGNCNGN
Sequence Type genomic DNA
Unitrap ID UNI35503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23565334..23565828 478
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020280 (Pus10) NM_001033654 pseudouridylate synthase 10 Gene [Source:MGI (curated);Acc:Pus10-004]

 
Come back to gene ENSMUSG00000020280


For any suggestions or comments, please send an email to unitrap@crg.es