Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13154D5
Clone ID IST13154D5
Vector VICTR74
Project tigm

Sequence tag IST13154D5HMF1
Sequence
AACTCTGGGTTCTCTGACTTTCCCTAGGCTGGTGTCCTATAGTGTTTAGTAAGACCTGGCTTCTGAGCGGTCCCTTTAAG
AGGGCCTTGTCCCAGACTCAGCTGTGGAATGCCAGTAAGCTGTCCTCTTGTCTCTGTGAGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72460598..72460741 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]


Sequence tag IST13154D5BBF1
Sequence
AACTCTGGGTTCTCTGACTTTCCCTAGGCTGGTGTCCTATAGTGTTTAGTAAGACCTGGCTTCTGAGCGGTCCCTTTAAN
AGGGCCTTGTCCCAGACTCAGCTGTGGAATGCCAGTAAGCTGTCCTCTTGTCTCTGTGAGGGTTAACAACACTTCACTTC
AGCTGTGTTGTCTGGAACCGGTTCAGACTGGTTCTCTGGAAAGTGCTTTGTCTCTCTGACTGCATCCTGGGAAGGGTCAT
GTGGAGCCCAGTGATGTCATGGGATCAAAAACTGACTCNNCGTTTTTCTCCCTTTTCTTTGAATCAAGATAAATGTGTGC
CACATGTACAGGGCCATGGTGGTGGCACTTTGGGATGGACCGGTCCATACTGTGCTCANANTGTATGTCTGCCNNCCAAA
AAGCTTANNATGANNCTCACTTCTGGCTCCCTGGGGGGCTCANGCACACAGCACCTGANGTCACCTCTATCNNNGTCCTA
CNNNCACCATTN
Sequence Type genomic DNA
Unitrap ID UNI471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72460251..72460741 453
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es