Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12778G8
Clone ID IST12778G8
Vector VICTR76
Project tigm

Sequence tag IST12778G8BBF1
Sequence
GCTGTCCTGGAATTTGTAATGTAGACCAGGATGCTCTTGAACTCACAGTGCTGGGTTAAAAGGCTGCACCACTGTGTGCA
GTTCCTAGCGGGGCTAGATAGATGAAACACCCCAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35018405..35018525 121
NO GENE  


Sequence tag IST12778G8HMF1
Sequence
GTGTCCTTGTTACGGTGAGGCCAGACTCCTTTCTGTGAGACACCCAAAAACTTACAGCCGCCTGTTCCCGTTGAGCAGCA
CTAACCTGGAACTCGGAGTCAATGGATTTTGGAAAAAATAAAAGAGAATAAAATAGGTATTTAGAGAGACCGATCTGGA
Sequence Type genomic DNA
Unitrap ID UNI17261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72661824..72661981 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es