Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14697E6
Clone ID IST14697E6
Vector VICTR76
Project tigm

Sequence tag IST14697E6HMF1
Sequence
GGTTGAAGGTTCAGTGTCTCACCCAACCNCCTGCACCAGGTGGGCAGCATGGCAGATGGAGATGCTGGGAGCCGCAGCAG
CTCGCGGTACAGCTGTAGGCCCATCCCCCAAATCTGANGAGAGGACCGTGCCACTGGGGAGGGGGCACTTCAAGANGCCA
ATGGGTGTAANCGGATATGCTGGACCCACCAGACTTGGCAGGATGGCAGATAACAGGATTTGTGATGGGTAGGACCTCCC
TGTACCACATGCTATCACCATGCTCCTGTGGGTAGCCNAAACAGGACTCCAACTGTCANANAGCNNGGGACCGATCCNCC
CCTAGGNCCTCCAGCANTCTCATGCCCAGGGCATGGCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123075186..123075544 335
NO GENE  


Sequence tag IST14697E6HMR1
Sequence
ANCCTCCCGCTGGATCTGAGGCAGCTTGCTTCACACAGGACATAGCTCTTCCCCCAGAGTGGTCCCGGCCCTGCTCCCAA
CCCACCCTTGTGCTGAGCCTACCCACTCATATCTGTGGAATGAGTCCAAGGACACCATCCCTTGTGATGGCTCCTGAGAT
GGCTTTGCACTGTCAGCGGCAGAGGCTGGGGGTCAAATATGTTGGCAGAGTGTTTCTTGGCTTCTGATGGGTTGAGGTGA
ACCACTCATTCCANATTCTN
Sequence Type genomic DNA
Unitrap ID UNI17018

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123075544..123075800 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es