Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST443585
Clone ID OST443585
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST443585
Sequence
ACTGAGGAGTGTGTTCCAGAGAACCTAAACTGAAAAAGAAGATCTTTGCCCAGCTGGACCGCATTGTGGATGACCGGNTT
ATCCTAAGCAGCTCCAGCTNTTGTCTGCTGCCTTCCAAGCTGTTCTCGGGCTTGGCTCATGTGAAGCAGTGCATTGTGGC
TCATCCTGTCAATCCACCATATTATGTCCCCCTGGTTGAGCTAGTGCCCCACCCAGAGACAGCATCCAGCCACANTGGAC
AGAACCTATGCCTTGATGAAGAAGATTGGGCAGNCCCCAGTGAGAGTCCTGAAGGAGATTGACGGCTTCNTCCTGAACCG
CCTGCAGTACGCCGTCATCAGNGAGGCCTGGAGACTGGTGGAGGAAGAAATANTATCTCCTAGCGACCTAGACCTGGTCA
TGTCAGACGGGCTGGGCATGCGGTACGCGTTCATCGGACCCTTGGAGACTATGCACCTCAATGCTGAAGGTGTGATTAGC
TACTGTGAGAGATACAGTGAAGGGATGAAGCACGTCCTCAGTACTTTCGGGCCTGTTCCAGAGTTCTCA
Sequence Type mRNA
Unitrap ID UNI17391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 57894781..57931968 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021947 (Cryl1) NM_030004 crystallin, lambda 1 Gene [Source:MGI Symbol;Acc:MGI:1915881]

 
Come back to gene ENSMUSG00000021947


For any suggestions or comments, please send an email to unitrap@crg.es