Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AB0058
Clone ID AB0058
Vector pGT0lxr
Project sanger

Sequence tag AB0058
Sequence
TGGTTGTGAGCTGTTTTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGGGATATGATAT
GCAGCATTCTTGAATACTTCTAATGACAGGGAGCCCACTACCTCATAAGCTGCAGCAACAAGAGGAGCTTGTAATTTTAA
ACGGAGGCTGAAGACACTGTAGAATTAGCAGACATAAGAGAGCGTGGAGAAGGCAGAGGATGGAGTTGCAGACTCTACAG
GAGGCTCTTAAAGTGGAAATTCAGGTTCACCAG
Sequence Type mRNA
Unitrap ID UNI3188

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92055654..92061772 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es